Introduction

 

The problem of soil salinization has been a consistent threat to the limited soil resources depended on by humans and is an increasingly serious environmental and ecological issue (Zhang et al. 2004). Studies have shown that salt damage to plant tissues is primarily caused by ionic and osmotic stress (Munns and Tester 2008), thereby inhibiting the normal growth of plants. Among the environmental factors that affect plant growth and development, the effect of soil salinity cannot be ignored (Munns 2005; Rozema and Flowers 2008). Salt stress affects the biochemical processes and metabolic pathways of plants, leading to reduced crop yields. Almost all major physiological processes of plants—such as photosynthesis, protein synthesis, energy and fat metabolism—are affected by salt stress to differential degrees. High salt levels can inhibit the growth of plant tissues and organs, significantly reduce the fresh and dry weight of plants, cause leaves to chloros and senesce, block root growth, and lead to premature aging or even death of plants (Lutts 1996). In recent decades, salt-tolerant plant germplasm resources and plant salt tolerance have been extensively studied (Munns and Tester 2008). The strategies to improve plant salt tolerance have long been a heavily researched issue in plant physiology and ecology research (Sun et al. 2014).

Tomato (Solanum lycopersicum L.), as one of the most economically important vegetables in the world, plays a great role in vegetable production and agronomic cultivation in China. The open cultivation and greenhouse cultivation of tomato are often affected by salt stress (Zhang and Blumwald 2001). Tomato is a medium salt-tolerant plant (Cuartero and Fernández-Muñoz 1999). Similar to other crops, salinity requirements differ at various stages of tomato growth and development. For example, the period of tomato seed germination and seedling growth is the most sensitive period to salt stress (Johnson et al. 1992). At present, studies examining the salt tolerance of tomato have primarily focused on early development (Al-Karaki 2000; Alian et al. 2000). The salt tolerance of plants varies with individual developmental stages (Asins et al. 1993). Plant hormones that are induced under salt stress also promote salt tolerance. In salt-sensitive cultivated tomato (L. esculentum; Lem), the antioxidant isoenzymes and oxidants induced by salt stress are downregulated, thereby increasing the oxidative damage. Contrarily, in salt tolerant tomato (L. pennellii; Lpa), the stress-induced upregulation of antioxidant isoenzymes and oxidants reduced the oxidative stress injury (Mittova et al. 2014).

Transcription factors (TFs) have an important effect on plant growth and development and stress response transformation by activating or inhibiting the transcription of target genes (Guo et al. 2014; Han et al. 2018). When plants are under biotic and abiotic stress, TFs can activate multiple defense mechanisms (Century et al. 2008). The BES1 transcription factor family is a type of plant-specific transcription factor that can regulate the BR signaling pathway (Yin et al. 2005). By activating the transcription of downstream genes to regulate the expression of BR target genes, BES1 ultimately regulates plant growth, development and stress resistance (Yin et al. 2002).

Wang et al. (2002) screened a BR synthesis inhibitory mutant, brassinazole-resistant 1-1D (bzr1-1D), and by map cloning identified the BZR1 gene, which encodes a nuclear protein and is induced by BR. In the same year, Yin et al. (2002) screened for the BR receptor inhibitor BES1, which was induced by BR and accumulated in the nucleus. It was later confirmed that BES1 is a BZR1-like protein with high sequence similarity. Yin et al. (2005) discovered a new class of transcription factors, BES1/BZR1, and confirmed that it is unique to plants and the only transcription factor in the BR signal transduction pathway. BRASSINOSTEROID INSENSITIVE2 (BIN2) is a negative regulator of the brassinolide pathway, and BES1/BZR1 can be phosphorylated to lose its original activity (Li et al. 2002; Rybel et al. 2009; Yan et al. 2009). In addition, a BRI1-SUPPRESSOR1 (BSU1) phosphatase upstream of BIN2 and BIN2 can be dephosphorylated to become inactivated, thereby deactivating BES1/BZR1 from BIN2 inhibition (Kim et al. 2009). PP2A is another phosphatase in the downstream pathway of BR, and scientific studies have demonstrated that it is a heterotrimer composed of three different subunits that dephosphorylate the substrate at the threonine and serine positions. Specifically, BZR1 can be dephosphorylated by PP2A, which becomes active and plays a normal role; therefore, it facilitates normalization of the BR signaling pathway (Tang et al. 2011). Currently, Arabidopsis thaliana has 8 members in the AtBES1/BZR1 gene family (Jiang et al. 2015), rice (Oryza stiva) has 4 members in the OsBES1/BZR1 gene family (Bai et al. 2007) and maize (Zea mays) has 11 members in the ZmBES1/BZR1 gene family (Kim et al. 2011; Manoli et al. 2018). Ye et al. (2017) found that BES1/BZR1 is antagonized by RD26 from the NAC transcription factor family. BES1/BZR1 combines with the RD26 gene promoter and inhibits RD26 expression, whereas RD26 protein binds to BES1/BZR1 protein and inhibits RD26 drought response regulation. During drought and starvation stress, SINAT E3 ligase and selective autophagy receptor DSK2 mediate the degradation of dephosphorylated BES1, allowing plants to halt growth under adverse conditions (Nolan et al. 2017; Yang et al. 2017).

In our previous study, nine BES1 transcription factor family members were identified in tomato, and most of these genes responded to cold, drought and salt stress (Gao et al. 2018). SLB3 is one of the genes that can cope with salt stress. In tomato plants, the gene was significantly upregulated under salt stress treatment. To further determine the function of SLB3, we used VIGS to reduce the expression of SLB3 in tomato plants, observe the phenotypic changes in plants, and analyze the effect of SLB3 silencing on the salt tolerance of plants.

 

Materials and Methods

 

Plant material

 

The species of tomato used in this experiment was “Moneymaker”, which was provided by the lab of genetic breeding in tomato of Northeast Agricultural University (Harbin, China). The tomato seedlings were planted at the Horticultural Experimental Station of Northeast Agricultural University. The soil composition ratio of turfy soil, vermiculite and perlite was 3:1:1.

 

Target fragment amplification and vector construction

 

TRIzol (Invitrogen, Shanghai, China) was used to extract total RNA from sample leaves. Following the manufacturer's instructions, we used a cDNA synthesis kit (Thermo Fisher, Beijing, China) to synthesize the first-strand cDNA. We downloaded the mRNA sequence of Solyc02g071990 from the Sol Genomics Network (https://www.solgenomics.org) and then designed the primers for SLB3, which contained specific enzyme sites (EcoRI and BamHI) and protective bases, using the online primer design tool at NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). The PCR product was analyzed by agarose gel electrophoresis, and the band with the correct was recovered and purified using a PCR purification kit (TaKaRa, Dalian, China).

The plasmid was extracted from bacterial solution containing TRV2. The TRV2 plasmid and the desired fragment were double digested with EcoRI and BamHI (Thermo Fisher, Beijing, China), and the digested plasmid and target fragment were joined with T4 DNA ligase. The successfully ligated TRV2 vector was introduced into Escherichia coli DH5α competent cells and incubated overnight at 37°C. We picked white clones from kanamycin-containing lysogeny broth (LB) medium and then cultured them in liquid LB culture amended with 50 μg/mL kanamycin, extracted plasmid from the bacterial solution and verified it by sequencing. The identified TRV2-SLB3 strain was cultured in liquid LB culture containing 50 μg/mL kanamycin and used for plasmid extraction. The recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101. A. tumefaciens GV3101 carrying the TRV2-PDS vector and TRV2-TRV1 vector used in this experiment were provided by the lab of genetic breeding in tomato of Northeast Agricultural University (Harbin, China). The phytoene dehydrogenase (PDS) used in this experiment is one of the rate-limiting enzymes affecting the synthesis of carotenoids and participates in linear carotenoid biosynthesis. PDS-silenced plants will turn white from the growing point and can be used as an indicator.

 

Infection of tomato seedlings

 

Seedlings with a center leaf and four functional leaves of similar size and good growth were selected for infection experiments. Three replicates were performed for each segment of interest. By using a syringe, the mixed solution was injected into the leaves and tender stems of tomato seedlings. The infected plants were placed in an environment with a temperature of 22°C and humidity of 60%, and cultivated under light intensity conditions of 120 μmol m-2 s-1 for 16 h followed by dark exposure for 8 h. PDS-silenced seedlings turned white approximately 20 days after infection. The overall whitening phenomenon gradually spread from the top growing point to the bottom and from the petioles to the veins of tomato leaves. This result confirmed that the PDS indicator gene was successfully and stably silenced in the tomato seedlings.

 

Determination of gene silencing efficiency

 

Leaf samples were taken from the silencing treatment and control plants. RNA was extracted and cDNA synthesized as described above. Primers were designed for amplification of the target fragment (Table 1). The gene silencing efficiency was determined by RT-qPCR, and the data were analyzed using the  method (Livak and Schmittgen 2001).

 

Analysis of the gene expression level in silenced plants under salt stress

 

SLB3-silenced seedlings, with a silencing efficiency of less than 50% compared with the control group, and control seedlings were cultivated in Hoagland's nutrient solution for 24 h. Then, the roots were soaked in 200 mM NaCl for 24 h. Phenotypic changes in the plants were observed at 1.5, 3, 6, 12 and 24 h after treatment, and the tomato leaves were removed and stored at -80°C. The leaves were subjected to RT-qPCR analysis. The experimental method was the same as described above.

 

Determination of SOD, POD, Pro and MDA contents

 

The SOD assay kit (SOD-1-Y), POD assay kit (POD-1-Y), Pro content assay kit (Pro-1-Y) and MDA content assay kit (MDA-1-Y) of Suzhou Comin Biotechnology Co., Ltd. (Suzhou, China) were used to measure SOD and POD activities and Pro and MDA contents. The above four kits were used according to the instructions.

 

Determination of reactive oxygen species (ROS)

 

In plant tissue, 3,3' diaminobenzidine (DAB) reacts with H2O2 to form a brown-red precipitate (Thordal-Christensen et al. 1997), and nitro-blue tetrazolium (NBT) reacts with O2-● to form a deep blue precipitate (Beyer and Fridovich 1987). According to the principle of the chemical reaction, the accumulation of H2O2 and O2-● in tomato leaves was observed by DAB and NBT staining methods. The leaves were stained with the prepared DAB, NBT solution for 24 h, and the dyed leaves were placed in anhydrous ethanol by heating in a boiling water bath for 10 min. The leaves were then placed on a glass slide for observation.

 

Statistical analysis

 

The data of this experiment were analyzed and plotted by Excel 2019. All data were mean ± standard error (SE) of three replicates.

 

Results

 

Verification of gene silencing efficiency

 

By comparing the SLB3 gene expression levels of the silenced, control and empty vector control plants, the SLB3 gene expression level was obviously decreased in most plants in the silenced group, but three plants showed normal expression levels of the SLB3 gene. Twelve successfully silenced plants showed a clearly downregulated expression pattern for subsequent experiments (Fig. 1).

 

Observing the plant phenotype after salt stress

 

As shown in Fig. 2, there was no obvious difference between the silenced and control plants 1.5 h after salt stress. In both groups, the leaves stretched, and the stems were slightly curved. Six hours after salt stress, compared with the control group, the phenotype was significantly different in the silenced group. Silenced plants had severely Table 1: Primers used for target fragment amplification and qRT-PCR analysis

 

Primer Name

(Restriction Site Sequence) Primer sequence (5′–3′)

VIGS Primer-F

GC(TCTAGA)ACACTTGGGAACTCCAGCAC

VIGS Primer-R

CG(GGATCC)ACTAACTGCTGCTCCTACC

qRT-PCR primer-F

CACGAGGCTACCGACATGGA

qRT-PCR primer-R

TCTTCAACAATCCAACCAGCCTCT

Actin Primer-F

ATTGGTGCTGAGAGGTTCCG

Actin Primer-R

CGGGAAACAGACAGGACACT

 

 

Fig. 1: Changes in SLB3 expression

SLB3-1~ SLB3-15: 15 SLB3-silenced plants

curved stems and wilted leaves. In the control group, the stems were slightly curved, and the leaves withered. After 24 h of high-salt treatment, the silenced and control groups suffered from severe water loss and extreme wilting.

 

Analysis of gene expression before and after silencing

 

We directly compared the expression levels of the SLB3 gene in the control, empty vector group and silenced group after salt stress treatment at the following 6 time points: 0, 1.5, 3, 6, 12 and 24 h, and collected leaves for RT-qPCR. The results suggested that the SLB3 gene expression level gradually increased under salt stress in the control and empty vector control group with similar gene expression at the same time (Fig. 3). The expression level in the silenced plants was consistently low.

 

Analysis of SOD, POD, Pro and MDA

 

The antioxidant capacity of plants under salt stress can be estimated by measuring SOD and POD activities and Pro and MDA contents. Based on the results, the SOD and POD activities and Pro and MDA contents in each group increased significantly (Fig. 4). After salt stress, POD activity and Pro content increased less and SOD activity and MDA content increased more in the silenced plants than the control and empty vector control plants.

 

Analysis of ROS content

 

The results on ROS are shown in Fig. 5. At the beginning of the experiment, the stained areas of control and gene-silenced plants were light, but they became darker after 6 h of salt stress treatment. After the same treatment time, the silenced plants were darker than the control plants.

 

Discussion

 

In our experiments, we used VIGS to downregulate the SLB3 gene. The RT-qPCR analysis results indicated that the success rate of gene silencing was 80% in 15 plants. Under normal circumstances, a lower gene expression level in plants after silencing than half the control plants was considered successful silencing. The average silencing efficiency in the 12 silenced plants was 75%. Li et al. (2013) explored the effects of SpMPK1, SpMPK2 and SpMPK3 genes in tomato on acid-mediated drought tolerance. The silencing efficiency was 80% (SpMPK1), 73% (SpMPK2) and 78% (SpMPK3). The efficiency of silencing in our study thus demonstrated an average level. The down-regulation of SLB3 gene expression caused an obviously different phenotype of the seedlings under salt stress. At 6 h after salt stress treatment, the control group displayed only a slightly curved main stem; the main stem of the SLB3-silenced treatment group was severely curved, the petiole was slightly curved, and the leaves were wilted. Under the same salt stress treatment conditions, SLB3-silenced plants withered faster and more seriously than control. Other analyses also demonstrated that SLB3 gene silencing affected plants. In terms of the present silencing efficiency, our experimental results are credible.

During normal physiological metabolism in plants, reactive oxygen species are inevitably produced. When plants are exposed to drought, high temperature, low temperature, salt, pests and other stresses, the production and elimination of ROS are imbalanced; therefore, the level of intracellular ROS exceeds the range that cells can tolerate and may ultimately cause cell death (Mittler 2002; Sharma et al. 2012). These ROS, including superoxide anion (O2-●), hydrogen peroxide (H2O2) and hydroxyl (OH-) radicals, can seriously damage plants (Shi et al. 2010). Antioxidant enzymes in plants, such as SOD, POD, catalase (CAT) and glutathione reductase (GR), work as ROS quenchers to protect cells from oxidative damage. Changes in antioxidant enzyme levels have been used to assess the impact of different abiotic stresses.

Free proline is a non-enzymatic metabolite. Under stress conditions, Pro acts as a stabilizer of subcellular structures, and a scavenger of free radicals (Nanjoa et al. 1999). Increases in Pro are beneficial to prevent cell dehydration and can alleviate damage to the membrane system. Kishor et al. (1995) have indicated a positive correlation between the accumulation of Pro and stress tolerance in plants. The main function of SOD and POD is to eliminate the intracellular ROS induced by stress, inhibit the accumulation of unsaturated fatty acids in the membrane and of MDA, maintain the stability and integrity of the plasma membrane, and enhance the plant body. The level of these enzyme activities and MDA content can reflect the strength of plant tolerance to some extent (Greenway and Munns 1980).

 

Fig. 2: Changes of phenotypic in control plants and SLB3-silenced plants under salt stress

 

 

Fig. 3: Time course expression of SLB3 gene in different plant under salt stress

 

 

Fig. 5: NBT and DAB staining

 

Fig. 4: The change of SOD and POD activity and Pro and MDA content in tomato plants under salt stress treatment

In this study, the activities of SOD and POD and the contents of Pro and MDA were measured to assess the antioxidant capacity of plants during salinity stress. After 3 h of salt treatment, Pro and MDA contents and POD activity were increased in all experimental groups. The content of Pro and activity of POD were extremely lower in silenced experimental materials than the control seedlings. The MDA content was markedly higher in the silenced than the control plants under the same conditions. This result indicates that adversity leads to an increase in superoxide radicals. To resist peroxidation of cell membranes by stress, the intracellular self-regulatory mechanism plays an important role, and antioxidant enzyme activity is enhanced. The degree of oxidation of lipids on the cell membrane is increased, which increases the membrane permeability and destroys the cell membrane system. The SOD content was increased in all plants after 3 h of salt stress treatment, and the MDA content was extremely elevated in SLB3-silened plants compared with the control seedlings. It is speculated that SLB3 gene silencing may be involved in the negative regulation of SOD. The above conclusions indicate that SLB3 gene silencing can reduce salt tolerance. Similar results were found in other studies on salt tolerance in tomato. In stress assays, SlbZIP1-RNAi transgenic plants showed reduced tolerance to salt stress, decreases in CAT activity and elevated MDA content (Zhu et al. 2018).

In abiotic stress tolerance-related gene function studies, at present, DAB and NBT staining methods are commonly used. In the presence of peroxidase, DAB reacts with H2O2 to produce a brown polymer, which makes it possible to observe the production of H2O2 in tomato leaves after DAB staining. The production of O2-● appears blue after the leaves are stained with NBT. The dyeing situation can visually show the damage in the plant under study. In the present research, by observing the stained area of the leaves, we concluded that the content of H2O2 and O2-● in tomato leaves increased with extension of the salt stress treatment time. Six hours after salt stress treatment, the size and color of the blue and brown areas were larger and darker on the leaves of the SLB3-silenced plants than the control group. The results revealed that silencing of the SLB3 gene resulted in greater damage to the plants by salt, which was consistent with the changes in POD activity and Pro and MDA contents.

In this experiment, there was no significant difference in phenotype between the control, empty vector control and SLB3-silenced group before salt stress treatment. This finding suggested that down-regulation of the SLB3 gene had little effect on plant growth. The SLB3 gene may play a vital part in the salt stress process.

 

Conclusion

 

The VIGS method was used to silence the SLB3 gene in tomato plants. Under the same salt stress conditions, the SLB3-silenced plants wilted faster and to a greater extent than the control plants. Physiological analysis indicted that after 3 h of salt stress, POD activity and Pro content were both increased in SLB3-silenced plants but to a lesser extent than in the control plants. SOD activity and MDA content increased to a greater extent in SLB3-silenced than control plants. Compared with the control, H2O2 and O2-● accumulated to a greater extent in leaves of SLB3-silenced plants. These results confirmed that SLB3 gene silencing affected tomato seedlings in the presence of salt treatment. Downregulation of the SLB3 gene reduced salt tolerance in tomato plants.

 

Acknowledgments

 

This research was supported by the China Agriculture Research System (No. CARS-23-A-16), National Key R&D Program of China (No. 2017YFD0101900), the University Nursing Program for Young Scholars with Creative Talents in Heilongjiang Province (No. UNPYSC2T-2018169) and Natural Science Foundation of Heilongjiang Province (No. C2017024).

 

Author Contributions

 

Yufang Bao planned and executed experiment, completed the data analysis, and wrote the first draft of the paper. Ziyu Wang, Yingmei Gao, Huanhuan Yang, He Zhang, Jingbin Jiang and Jingfu Li participated in experimental design and analyzed experimental data. Tingting Zhao and Xiangyang Xu contributed to the central idea, guided experimental design, data analysis, dissertation writing and revision. All authors read and agreed with the final draft.

 

References

 

Al-Karaki GN (2000). Growth, sodium, and potassium uptake and translocation in salt stressed tomato. J Plant Nutr 23:369–379

Alian A, A Altman, B Heuer (2000). Genotypic difference in salinity and water stress tolerance of fresh market tomato cultivars. Plant Sci 152:59–65

Asins MJ, MP Bretó, M Cambra, EA Carbonell (1993). Salt tolerance in Lycopersicon species. I. Character definition and changes in gene expression Theor Appl Genet 86:737–743

Bai M, L Zhang, SS Gampala, S Zhu, W Song, K Chong, Z Wang (2007). Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice Proc Natl Acad Sci USA 104:13839–13844

Beyer WF, I Fridovich (1987). Assaying for superoxide dismutase activity: Some large consequences of minor changes in conditions. Anal Biochem 161:559–566

Century K, TL Reuber, OJ Ratcliffe (2008). Regulating the regulators: The future prospects for transcription-factor-based agricultural biotechnology products. Plant Physiol 147:20–29

Cuartero J, R Fernández-Muñoz (1999). Tomato and salinity. Sci Hortic 78:83–125

Gao Y, J Hu, T Zhao, X Xu, J Jiang, J Li (2018). Genome-wide identification and expression pattern analysis of BRI1-EMS–suppressor transcription factors in tomato under abiotic stresses. J Amer Soc Hortic Sci 143:84–90

Greenway H, R Munns (1980). Mechanims of salt tolerance in nonhalphytes. Annu Rev Plant Physiol 31:149–190

Guo J, S Lofgren, A Farrel (2014). Structure-based prediction of transcription factor binding sites. Tsinghua Sci Technol 19:568–577

Han D, Y Hou, H Ding, Z Zhou, H Li, G Yang (2018). Isolation and preliminary functional analysis of MbWRKY4 gene involved in salt tolerance in transgenic tobacco. Intl J Agric Biol 20:2045‒2052

Jiang J, C Zhang, X Wang (2015). A recently evolved isoform of the transcription factor BES1 promotes brassinosteroid signaling and development in Arabidopsis thaliana. Plant Cell 27:361–374

Johnson DW, SE Smith, AK Dobrenz (1992). Genetic and phenotypic relationships in response to NaCl at different developmental stages in alfalfa Theor Appl Genet 83:833–838

Kim TW, S Guan, AL Burlingame, Z Wang (2011). The CDG1 kinase mediates brassinosteroid signal transduction from BRI1 receptor kinase to BSU1 phosphatase and GSK3-like kinase BIN2. Mol Cell 43:561–571

Kim TW, S Guan, Y Sun, Z Deng, W Tang, J Shang, Y Sun, AL Burlingame, Z Wang (2009). Brassinosteroid signal transduction from cell surface receptor kinases to nuclear transcription factors. Nat Cell Biol 11:1254–1260

Kishor PBK, Z Hong, CH Miao, CA Hu, DPS Verma (1995). Overexpression of △1-pyrroline-5-carboxylate synthetase lncreases proline production and confers osmotolerance in transgenic plants. Plant Physiol 108:1387–1394

Li C, J Yan, Y Li, Z Zhang, Q Wang, Y Liang (2013). Silencing the SpMPK1, SpMPK2, and SpMPK3 genes in tomato reduces abscisic acid-mediated drought tolerance. Intl J Mol Sci 14:21983–21996

Li J, J Wen, KA Lease, JT Doke, FE Tax, JC Walker (2002). BAK1, an Arabidopsis LRR Receptor-like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell 110:213–222

Livak KJ, TD Schmittgen (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2^(-△△C_T ) method. Methods 25:402–408

Lutts S (1996). NaCl-induced senescence in leaves of rice (Oryza sativa L.) cultivars differing in salinity resistance. Ann Bot 78:389–398

Manoli A, S Trevisan, S Quaggiotti, S Varotto (2018). Identification and characterization of the BZR transcription factor family and its expression in response to abiotic stresses in Zea mays L. Plant Growth Regul 84:423–436

Mittler R (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:405–410

Mittova V, M Volokita, M Guy (2014). Antioxidative systems and stress tolerance: Insight from wild and cultivated tomato species. Reactive Oxygen Nitrogen Species 23:89–131

Munns R (2005). Genes and salt tolerance: Bringing them together. New Phytol 167:645–663

Munns R, M Tester (2008). Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651–681

Nanjoa T, M Kobayashia, Y Yoshibab, Y Kakubaric, K Yamaguchi-Shinozakid, K Shinozaki (1999). Antisense suppression of proline degradation improves tolerance to freezing and salinity in Arabidopsis thaliana. FEBS Lett 461:205–210

Nolan TM, B Brennan, M Yang, J Chen, M Zhang, Z Li, X Wang, DC Bassham, J Walley, Y Yin (2017). Selective autophagy of BES1 mediated by DSK2 balances plant growth and survival. Dev Cell 41:33–46

Rozema J, T Flowers (2008). Crops for a salinized world. Science 322:1478–1480

Rybel BD, D Audenaert, G Vert, W Rozhon, J Mayerhofer, F Peelman, S Coutuer, T Denayer, L Jansen, L Nguyen, I Vanhoutte, GTS Beemster, K Vleminckx, C Jonak, J Chory, D Inzé, E Russinova, T Beeckman (2009). Chemical inhibition of a subset of Arabidopsis thaliana GSK3-like kinases activates brassinosteroid signaling. Chem Biol 16:594–604

Sharma P, AB Jha, RS Dubey, M Pessarakli (2012). Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J Bot 2012; Article 217037

Shi S, Z Shi, Z Jiang, L Qi, X Sun, C Li, J Liu, W Xiao, S Zhang (2010). Effects of exogenous GABA on gene expression ofCaragana intermediaroots under NaCl stress: Regulatory roles for H2O2 and ethylene production. Plant Cell Environ 33:149–162

Sun J, X Peng, W Fan, M Tang, J Liu, S Shen (2014). Functional analysis of BpDREB2 gene involved in salt and drought response from a woody plant Broussonetia papyrifera. Gene 535:140–149

Tang W, M Yuan, R Wang, Y Yang, C Wang, JA Oses-Prieto, TW Kim, H Zhou, Z Deng, SS Gampala, JM Gendron, EM Jonassen, C Lillo, A Delong, AL Burlingame, Y Sun, ZY Wang (2011). PP2A activates brassinosteroid-responsive gene expression and plant growth by dephosphorylating BZR1. Nat Cell Biol 13:124–131

Thordal-Christensen H, Z Zhang, Y Wei, DB Collinge (1997). Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant J 11:1187–1194

Wang Z, T Nakano, J Gendron, J He, M Chen, D Vafeados, Y Yang, S Fujioka, S Yoshida, T Asami, J Chory (2002). Nuclear-localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis. Dev Cell 2:505–513

Yan Z, J Zhao, P Peng, RK Chihara, J Li (2009). BIN2 functions redundantly with other Arabidopsis GSK3-like kinases to regulate brassinosteroid signaling. Plant Physiol 150:710–721

Yang M, C Li, Z Cai, Y Hu, T Nolan, F Yu, Y Yin, Q Xie, G Tang, X Wang (2017). SINAT E3 ligases control the light-mediated stability of the brassinosteroid-activated transcription factor BES1 in Arabidopsis. Dev Cell 41:47–58

Ye H, S Liu, B Tang, J Chen, Z Xie, TM Nolan, H Jiang, H Guo, HY Lin, L Li, Y Wang, H Tong, M Zhang, C Chu, Z Li, M Aluru, S Aluru, PS Schnable, Y Yin (2017). RD26 mediates crosstalk between drought and brassinosteroid signalling pathways. Nat Commun 8; Article 14573

Yin Y, D Vafeados, Y Tao, S Yoshida, T Asami, J Chory (2005). A new class of transcription factors mediates brassinosteroid-regulated gene expression in Arabidopsis. Cell 120:249–259

Yin Y, Z Wang, S Mora-Garcia, J Li, S Yoshida, T Asami, J Chory (2002). BES1 accumulates in the nucleus in response to brassinosteroids to regulate gene expression and promote stem elongation. Cell 109:181–191

Zhang H, E Blumwald (2001). Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nat Biotechnol 19:765–768

Zhang J, S Xing, J Li, F Makeschin, Y Song (2004). Agroforestry and its application in amelioration of saline soils in eastern China coastal region. For Stud Chin 6:27–33

Zhu M, X Meng, J Cai, G Li, T Dong, Z Li (2018). Basic leucine zipper transcription factor SlbZIP1 mediates salt and drought stress tolerance in tomato. BMC Plant Biol 18; Article 83